Google: People Also Ask

March 24th, 2024 at 7:54:23 AM permalink
odiousgambit
Member since: Oct 28, 2012
Threads: 166
Posts: 6519
In the US, trans is gone. Fat, I mean, not the other unfortunately
I'm Still Standing, Yeah, Yeah, Yeah [it's an old guy chant for me]
March 24th, 2024 at 9:05:01 AM permalink
rxwine
Member since: Oct 24, 2012
Threads: 218
Posts: 23195
They'll be gone when humans disappear.

Quote:
. 7,000 BCE – c. 1700 BCE – Among the sexual depictions in Neolithic and Bronze Age drawings and figurines from the Mediterranean are, as one author describes it, a "third sex" human figure having female breasts and male genitals or without distinguishing sex characteristics. In Neolithic Italy, female images are found in a domestic context, while images that combine sexual characteristics appear in burials or religious settings. In Neolithic Greece and Cyprus, figures are often dual-sexed or without identifying sexual characteristics.[2]
c. 2900 BCE – c. 2500 BCE – A burial of a suburb of Prague, Czech Republic, a male is buried in the outfit usually reserved for women. Archaeologists speculate that the burial corresponds to a transgender person or someone of the third sex.[3]
c. 400 BCE – Ancient Greek physician Hippocrates writes of the enarei, a class of androgynous Scythian priests and healers; "there are many eunuchs among the Scythians, who perform female work, and speak like women".[4][5] The enarei are also mentioned around the same time in Herodotus' work Histories; "the Scythians who plundered the temple were punished by the goddess with the female sickness, which still attaches to their posterity. They themselves confess that they are afflicted with the disease for this reason, and travellers who visit Scythia can see what sort of a disease it is. Those who suffer from it are called Enarees".[6]


https://en.wikipedia.org/wiki/Timeline_of_transgender_history
"Trumpsplain (def.) explaining absolute nonsense said by TRUMP.
March 24th, 2024 at 9:09:59 AM permalink
rxwine
Member since: Oct 24, 2012
Threads: 218
Posts: 23195
Actually, I don't know why it isn't acceptable as anyone who is born in other variations of humanity. They just don't happen to be related to sex so directly.
"Trumpsplain (def.) explaining absolute nonsense said by TRUMP.
March 24th, 2024 at 9:16:39 AM permalink
rxwine
Member since: Oct 24, 2012
Threads: 218
Posts: 23195
Does variation stop when it's sex or gender?

Not a bold prediction to say it doesn't. But a bold prediction to say it does.
"Trumpsplain (def.) explaining absolute nonsense said by TRUMP.
March 25th, 2024 at 5:58:44 AM permalink
odiousgambit
Member since: Oct 28, 2012
Threads: 166
Posts: 6519
I'm glad to see what seems to be the most modern recommendation as to the amount of water you should drink everyday has been changed to monitoring your urine instead of slavishly drinking more water than you want. Recently I watched a video while waiting to submit a blood sample that said, with emphasis, that the recommendation amounted to 'nearly a gallon' for a man. Insane and actually dangerous if it leads to drinking too much at one time!

The first below is what we heard for years and can still be one of the answers when googled. It doesn't even mention water from food, which can be substantial. The next below gives the facts on food. The next after that below is the current recommendation [as far as I can tell]. The last below is about water poisoning

Personally, I'd advise not drinking more than one glass of water per day that you really don't want, though that one glass might be a good practice. Otherwise, monitor your urine for dehydration that for some reason you were unaware of.

my comments in brackets

>>>

How many oz of water should I drink a day?

On average, a healthy adult should take in the following amounts per day: 3.7 liters (15.5 cups or 125 ounces) for men. 2.7 liters (11.5 cups or 91 ounces) for women. [125 ounces is 3 ounces less than a gallon and if you were to interpret that to mean drinking that amount in addition to other intake, as the video seemed to do, that's a problem]
__

how much water comes from food digestion?

about 20%
Water in our food The body can get about 20% of its total water requirements from solid foods alone. The process of digesting foods also produces a small amount of water as a by-product which can be used by the body. Water sourced this way can provide around 10% of the body's water requirements. [think about the word "carbohydrate" and what that means]
__

Daily fluid intake Most people should aim to drink enough during the day so their pee is a clear pale yellow colour. The Eatwell Guide recommends that people should aim to drink 6 to 8 cups or glasses of fluid a day. Water, lower-fat milk and sugar-free drinks, including tea and coffee, all count.
__

How much water is an unsafe amount?

The Centers for Disease Control and Prevention advises people not to drink more than 48 ounces, or six cups, per hour. Too much water or other fluids, such as sports drinks, can cause a medical emergency because the concentration of salt in the blood becomes too low.Jul 12, 2023
I'm Still Standing, Yeah, Yeah, Yeah [it's an old guy chant for me]
March 25th, 2024 at 6:13:35 AM permalink
DoubleGold
Member since: Jan 26, 2023
Threads: 34
Posts: 4259
The water to body weight ratio is usually over 39% and under 73%.

I go by the thirst sensation.



----------------

Total body water = 2.447 - (0.09156 * Age) + (0.1074 * Height) + (0.3362 * Weight)

https://www.merckmanuals.com/medical-calculators/TBW_M_Watson.htm

----------------



Being an ex-jock, I learned straight water will reduce potassium and sodium percentages.

I've learned if I get cramps in my legs while sleeping, I need more of each element.

A banana will usually do it, because there's plenty of sodium in foods.

But a banana down here is not like a banana up there.
March 27th, 2024 at 6:58:52 AM permalink
odiousgambit
Member since: Oct 28, 2012
Threads: 166
Posts: 6519
Quote: DoubleGold
The water to body weight ratio is usually over 39% and under 73%.

I go by the thirst sensation.
I think almost all of us can go by thirst, although I wonder about the frail elderly from what I have heard. It may be good to drink a glass of water once in a while even when not really thirsty, but obsessing over the need for a gallon of fluids is nuts
I'm Still Standing, Yeah, Yeah, Yeah [it's an old guy chant for me]
March 27th, 2024 at 6:58:59 AM permalink
odiousgambit
Member since: Oct 28, 2012
Threads: 166
Posts: 6519
I've been wanting to post this one for a while, but I needed to find time to type it in

why do I like the author Louis Begley? Here's an excerpt from "The New Life of Hugo Gardner"

>>>

[Hugo gets an email saying he should sign in to his Health provider website to see a private message] .... The curmudgeon coiled up inside me wished to inquire why it had been necessary for the hospital to dispatch an email that sent me scrambling to read a message on its website when it would have sufficed for her to give me a call, thus saving me time and sparing me twenty minutes of needless irritation. I told the old fellow to shut up. The secretary was a nice lady; it was not she but some high-salary geeks in the hospital's Internet Technology department who had invented that idiotic system, and my self-interest required me to remain on good terms with her. "
I'm Still Standing, Yeah, Yeah, Yeah [it's an old guy chant for me]
March 27th, 2024 at 1:42:03 PM permalink
DoubleGold
Member since: Jan 26, 2023
Threads: 34
Posts: 4259
Quote: odiousgambit
I think almost all of us can go by thirst, although I wonder about the frail elderly from what I have heard. It may be good to drink a glass of water once in a while even when not really thirsty, but obsessing over the need for a gallon of fluids is nuts



Here's a reference:

-------------------

The cellular basis of distinct thirst modalities

2020 Oct 14
.
.
.
In the mammalian brain, fluid imbalance is detected by LT CVOs, the sensory organs of the brain that lack the normal blood-brain barrier7. The subfornical organ (SFO) and organum vasculosum lamina terminalis (OVLT) are the forebrain CVOs that sense internal fluid status and regulate drinking behavior through their downstream brain sites. The majority of excitatory neurons in these CVOs are activated under dehydration, and acute stimulation of the same population instantly drives thirst8–10, highlighting the causal relationship between SFO and OVLT excitatory neurons with thirst.

Peripheral sensory systems such as taste and olfaction can detect multiple stimuli through unique cell types. Similarly, the brain can detect at least two distinct thirst-inducing stimuli: osmolality increase and volume decrease in the systemic circulation. Moreover, these two thirst types, osmotic and hypovolemic thirst drive quite different fluid intake patterns1. When the brain detects osmolality elevation, animals only consume water to alleviate hyperosmotic stress. Conversely, reduced systemic volume induces vigorous intake of both water and salts to recover blood volume at the appropriate osmolality. Natural dehydration is a combination of these two stimuli. Therefore, while both types of thirst trigger drinking behavior, solute preference is drastically different to achieve distinct internal consequences. The work in the past several decades revealed histological and behavioral aspects of individual thirst stimuli in exquisite detail11. Nevertheless, the neural basis underlying distinct thirst modalities remain unexplored. Here, we employ single-cell transcriptomic, neural manipulation, and genetic approaches to demonstrate that each dipsogenic stimulus is represented by a unique combination of CVO neurons of the LT. Furthermore, optogenetic activation of these neural populations triggered distinct drinking outputs corresponding to respective thirst states.
.
.
.
https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7718410/

---------------------



It would look something like this if I took the time to locate the actual DNA molecules responsible for thirst.

-----------------

1|>NT_187419.1 Homo sapiens unplaced genomic scaffold, GRCh38.p13 Primary Assembly HSCHRUN_RANDOM_123
2|CGTtcactcacagattttaacctttcttttcatagagcagtctggaaacactctgtttgtaaagtctgcaagaggatatt
3|tggacctctttgagcccttctttggaaacgggatttcttcatatactgctagacagaataaaTCTTAATAACTTccttgg
4|gttgtgtgtattcaactcatagagttgaaacttcctttagagagagcagatgtgCAATACtcttttttgtgatatttgca
5|cgtggagatttctagcgcttttaggccaaaaatagaaaaggaaatacctttgtacaaaaactatacagaatcattctgag
6|aatctactttgtgatgtgtgcattcaattcacagagtttaacctttcctttgattgtgcagtttggaaaccctctctttg
7|taaattctgcaagtggatatatggacctctttttggccttcgttggaaaaggtatttcttcattgaatgttagacagaag
8|aattctcagtaccttatatgtgttgtgtgctttcaactcacagtgttgaaccttcctttacataaagcagatttgaaaca
9|ttctttttgtggatttcccaggtggagatttcaatcgcctcgaggccaatggtagaaaaggtaatatcttcatataaaaa
10|caagacaaaatcgttctctgaaactactttgtgatgtgtgcgttcaactcacagagtttaatctttcttttcatagagca
11|gtttggaaacactctgtttgtaatgtctgcaagtggatattttgatctatttgaggccttcgttggaaacgggatttttt
12|catgtaatgctagaaagaagaatcctcagtaacttctttgtgttgcatgtattcaactcacagaggtgaaccatCCTTTA
13|GACGGAGaagatgtgaaacactctttttgttaaatttgcaggtggagatttcaagcgatttgaggccaacggtaggaaag
14|gaattatcttcgtataaaaggtagacagaatcattctcagaaactattttgtgatgtgtgcattcaactcacagagttta
15|aattttcttttcatagagcagttcggaaatactctgtttgtaaggtgtgcaagtggatatttggacctctttgagccctt
16|ctttggcaacgggatttcttcttatattgcttgacagaagaattctcagtaactttttgtgttgtgtgtattccactcac
17|agacttgaaccttcctttagagagaggagatttgacacactctttttgtggaatttccagaTGGAATTTTCAgttgcttt
18|gaggccaatgacagaaaaggaaatattttcgtataaaaactagacagaatctttctgagaaactactttgtgatgtgtgc
19|a

-------------


It dawned on me today about an invisible God existing.


The file I'm working with for the human genome is about 3 GB in length.

It's huge.

In one human cell of trillions in our body, there is the equivalent of 3 GB of data in data storage capacity.

So about 7 trillion (cells) times 3 GB (each cell).

Except DNA is 3D (or more dimensions LOL).


There's no way there's not a God.
March 28th, 2024 at 5:48:37 AM permalink
odiousgambit
Member since: Oct 28, 2012
Threads: 166
Posts: 6519
Here's an interesting journey

Somewhere [here?] I saw that you shouldn't put your laptop on your lap ... some lady got cancer and felt it came from doing this. This is classic post hoc, propter hoc fallacy [assuming she's wrong, ha]. So I decided to check the claim out on the internet that laptops generate harmful radiation. Apparently not, though there are claims otherwise [some Indian sites definitely claim this, and others]

But searching directed me to another reason to be careful. I’ll let you take the journey

>>>

should you put your laptop on your lap?

reason #6. If you spend vast amounts of time reading, studying or playing games on a laptop resting on your lap, you could develop “toasted skin syndrome.” ... This condition, also known as “erythema ab igne” develops over time depending on how much the laptop is used on the lap and how hot it usually gets.

https://vesttech.com/6-reasons-you-should-never-place-your-laptop-on-your-lap/ [this co. sells radiation protection things]

__

can your laptop give you erythema ab igne?

Prolonged contact of the laptop with the skin can lead to the development of erythema ab igne.

__

What is erythema ab igne from a laptop?

Erythema ab igne is a condition characterized by reticulated macular hyperpigmented lesions caused by repeated exposure to moderate intensity heat. The condition has reemerged in the last years because of the increasing use of portable computers or laptops and other heat source apparatus.

__

Should I see a doctor for erythema ab igne?

Long-standing erythema ab igne in the presence of other secondary changes such as ulceration or hyperkeratosis should prompt a dermatologist referral for biopsy and further management.

__

Does erythema ab igne go away?

While it usually resolves in weeks to months after the removal of the heat source, the rash has a propensity to become permanent, and in some cases, transforms into cutaneous malignancies [5-7]. Both patients and providers must be aware of the association of this rash with repeated heat exposure

__

are people getting erythema ab igne a lot now?

Historically, erythema ab igne would occur in individuals repeatedly exposed to heat such as bakers, metalworkers or individuals spending long periods next to fires. As the availability of central heating increased, the incidence of erythema ab igne has decreased in developed countries.

__

does erythema ab igne develop into cancer?

While erythema ab igne carries a favorable prognosis, squamous cell carcinoma and Merkel cell carcinoma have been reported to arise within lesions of erythema ab igne. If lesions of erythema ab igne continue to evolve or ulcerate, biopsy should be performed to rule out malignancy.

__
I'm Still Standing, Yeah, Yeah, Yeah [it's an old guy chant for me]